View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_59 (Length: 274)
Name: NF0900_low_59
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 145 - 244
Target Start/End: Complemental strand, 3350881 - 3350786
Alignment:
| Q |
145 |
gaagcaagttaatatgataactcataatctagttaggatgataattttctatgctagtcgtctaagtctttgattttgctcttccttatatttcatctct |
244 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3350881 |
gaagcaagttaatat---aacttgtaatctagttaggatgataattttctatgctagtcgtc-aagtctttgattttgctcttccttatatttcatctct |
3350786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 101
Target Start/End: Complemental strand, 46864058 - 46864023
Alignment:
| Q |
66 |
atgttaattgattaataaaatactgtcaaatacgtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46864058 |
atgttaattgattaataaaatactgtcaaatacgtt |
46864023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 101
Target Start/End: Complemental strand, 5054952 - 5054917
Alignment:
| Q |
66 |
atgttaattgattaataaaatactgtcaaatacgtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5054952 |
atgttaattgattaataaaatactgtcaaatacgtt |
5054917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 74 times since January 2019
Visitors: 6695