View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0900_low_59 (Length: 274)

Name: NF0900_low_59
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0900_low_59
NF0900_low_59
[»] chr4 (1 HSPs)
chr4 (145-244)||(3350786-3350881)
[»] chr3 (1 HSPs)
chr3 (66-101)||(46864023-46864058)
[»] chr2 (1 HSPs)
chr2 (66-101)||(5054917-5054952)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 145 - 244
Target Start/End: Complemental strand, 3350881 - 3350786
Alignment:
145 gaagcaagttaatatgataactcataatctagttaggatgataattttctatgctagtcgtctaagtctttgattttgctcttccttatatttcatctct 244  Q
    |||||||||||||||   ||||  |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
3350881 gaagcaagttaatat---aacttgtaatctagttaggatgataattttctatgctagtcgtc-aagtctttgattttgctcttccttatatttcatctct 3350786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 101
Target Start/End: Complemental strand, 46864058 - 46864023
Alignment:
66 atgttaattgattaataaaatactgtcaaatacgtt 101  Q
    ||||||||||||||||||||||||||||||||||||    
46864058 atgttaattgattaataaaatactgtcaaatacgtt 46864023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 101
Target Start/End: Complemental strand, 5054952 - 5054917
Alignment:
66 atgttaattgattaataaaatactgtcaaatacgtt 101  Q
    ||||||||||||||||||||||||||||||||||||    
5054952 atgttaattgattaataaaatactgtcaaatacgtt 5054917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University