View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_60 (Length: 270)
Name: NF0900_low_60
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 26 - 221
Target Start/End: Original strand, 35200254 - 35200450
Alignment:
Q |
26 |
gagtatcataggttatatcttttaagattggttaatattctaagattttttcttatttctaacagttccaaacagaatggtattgtactactgttgcatt |
125 |
Q |
|
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35200254 |
gagtatcattgtttatatcttttaagattggttaatattctaagattttttcttatttctaacagttccaaacagaatggtattgtactactgttgcatt |
35200353 |
T |
 |
Q |
126 |
tctccttttcggtttcacggctaccttc-tttaatctacacattccattccaggttactactcttctggtgattttgaggattactatctaggctat |
221 |
Q |
|
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35200354 |
tctccttttcggtttcacggataccttcttttaatctacacattccattccaggttactactcttctggtgattttgaggattactatctaggctat |
35200450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University