View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_62 (Length: 268)
Name: NF0900_low_62
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_62 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 30 - 268
Target Start/End: Original strand, 48449855 - 48450098
Alignment:
Q |
30 |
cttcatcctttccttccttcttggt------gcttctaccggtgctactcaaagtaagtccaaaacaagnnnnnnnattttatttctcagatttggaatc |
123 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
48449855 |
cttcatcctttccttccttcttggtcttggtgcttctaccagtgctactcaaagtaagtccaaaacaagtttttttattttatttctcagatttggaatc |
48449954 |
T |
 |
Q |
124 |
ttaatgttactgcttatgtaatatgattttgatctggtatataataacttgnnnnnnnntgtgatttttatatctttagtgttaatctttccaatgtagc |
223 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
48449955 |
ttaatgttactgcttatgtaatatgagtttgatctggtatataataacttg-aaaaaaatatgatttttatatctttaatgttattctttccaatgtagc |
48450053 |
T |
 |
Q |
224 |
atttcacagtgattcagctagctgttttatgactagatcttaatt |
268 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48450054 |
atttcacagtgattcagctagctgttttatgactagatcttaatt |
48450098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University