View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_64 (Length: 267)
Name: NF0900_low_64
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 46 - 181
Target Start/End: Complemental strand, 31233289 - 31233154
Alignment:
Q |
46 |
ctttccaccaaaaaatgatggctaaggggatcaaaacagtgcaagactttcttaaattagcagttattgatactccaaagctaagagaggtatctatttt |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31233289 |
ctttccaccaaaaaatgatggctaaggggatcaaaacagtgcaagactttcttaaattagcagttattgatactccaaagctaagagaggtatctatttt |
31233190 |
T |
 |
Q |
146 |
tatgctaatttagttcataaaaaagtcttttacttc |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
31233189 |
tatgctaatttagttcataaaaaagtcttttacttc |
31233154 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 46 - 148
Target Start/End: Complemental strand, 31242431 - 31242329
Alignment:
Q |
46 |
ctttccaccaaaaaatgatggctaaggggatcaaaacagtgcaagactttcttaaattagcagttattgatactccaaagctaagagaggtatctatttt |
145 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
T |
31242431 |
ctttccaccacaaaatgatggctaaggggatcaaaacggtgcaagactttcttaaattagcagttattgatactccaaagctaagagaggtatatatctt |
31242332 |
T |
 |
Q |
146 |
tat |
148 |
Q |
|
|
||| |
|
|
T |
31242331 |
tat |
31242329 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University