View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0900_low_69 (Length: 265)

Name: NF0900_low_69
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0900_low_69
NF0900_low_69
[»] chr6 (1 HSPs)
chr6 (1-236)||(10151422-10151658)
[»] chr7 (1 HSPs)
chr7 (5-108)||(33197375-33197478)


Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 10151422 - 10151658
Alignment:
1 tctctaggaagagatgctgctactggaagaggtgtcctctttgcgactgaggctttgcttaatgaatatggaaagagtgtatctggtcaacggtttgtca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10151422 tctctaggaagagatgctgctactggaagaggtgtcctctttgcaactgaggctttgcttaatgaatatggaaagagtgtatctggtcaacggtttgtca 10151521  T
101 tacaggtacnnnnnnnatattaccctaattagaaacactaactagttttaaatcgcggtcgtag-tgtgtcagattttacatattacgaagaatcatgat 199  Q
    |||||||||       |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||    
10151522 tacaggtactttttttatattaccctaattagaaacactaactagttttaaatcgcggtcgtagttgtgtcacattttacatattacgaagaatcatgat 10151621  T
200 taaatgcagtcgatgcaatctaactcacggtcgtaga 236  Q
    ||||||||||||||||| ||||| |||| ||||||||    
10151622 taaatgcagtcgatgcagtctaattcactgtcgtaga 10151658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 33197375 - 33197478
Alignment:
5 taggaagagatgctgctactggaagaggtgtcctctttgcgactgaggctttgcttaatgaatatggaaagagtgtatctggtcaacggtttgtcataca 104  Q
    |||| |||||||| ||||| |||||||| ||| | |||||  | ||||||||||||||||| || || |||||| ||||||| |||||||| ||||| ||    
33197375 taggtagagatgcagctacaggaagaggagtcatgtttgcagcagaggctttgcttaatgagtacgggaagagtatatctggacaacggttcgtcattca 33197474  T
105 ggta 108  Q
    ||||    
33197475 ggta 33197478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University