View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_70 (Length: 265)
Name: NF0900_low_70
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_70 |
 |  |
|
| [»] scaffold0214 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 40 - 239
Target Start/End: Complemental strand, 34225919 - 34225724
Alignment:
| Q |
40 |
gcttgcacatgagaatgtattttctgccaaattgaaggttatgcttggatcaattaacgattcttctttgatttcataggtgtctttaatttcttttata |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225919 |
gcttgcacatgagaatgtattttctgccaaattgaaggttatgcttggatcaat----gattcttctttgatttcataggtgtctttaatttcttttata |
34225824 |
T |
 |
| Q |
140 |
agttctatgagggataccatagaaaaccatgcagaaatgtaccttatttaaagttaaattagcaactagtaactctagatttcatacacgtgattatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34225823 |
agttctatgagggataccatagaaaaccatgcagaaatgtaccttatttaaagttaaattagcaactagtaactctagatttcatccacgtgattatatt |
34225724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 40 - 239
Target Start/End: Complemental strand, 34230047 - 34229852
Alignment:
| Q |
40 |
gcttgcacatgagaatgtattttctgccaaattgaaggttatgcttggatcaattaacgattcttctttgatttcataggtgtctttaatttcttttata |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34230047 |
gcttgcacatgagaatgtattttctgccaaattgaaggttatgcttggatcaat----gattcttctttgatttcataggtgtctttaatttcttttata |
34229952 |
T |
 |
| Q |
140 |
agttctatgagggataccatagaaaaccatgcagaaatgtaccttatttaaagttaaattagcaactagtaactctagatttcatacacgtgattatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34229951 |
agttctatgagggataccatagaaaaccatgcagaaatgtaccttatttaaagttaaattagcaactagtaactctagatttcatccacgtgattatatt |
34229852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: scaffold0214
Description:
Target: scaffold0214; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 40 - 143
Target Start/End: Complemental strand, 29393 - 29294
Alignment:
| Q |
40 |
gcttgcacatgagaatgtattttctgccaaattgaaggttatgcttggatcaattaacgattcttctttgatttcataggtgtctttaatttcttttata |
139 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29393 |
gcttgcacatgagactgtattttctgtcaaattgaaggttatgcttggatcaat----gattcttctttgatttcataggtgtctttaatttcttttata |
29298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 38 - 92
Target Start/End: Complemental strand, 12267820 - 12267766
Alignment:
| Q |
38 |
cagcttgcacatgagaatgtattttctgccaaattgaaggttatgcttggatcaa |
92 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
12267820 |
cagcttgcacatgagaatgcattttctgccatattgaaggttaggctttgatcaa |
12267766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University