View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_78 (Length: 256)
Name: NF0900_low_78
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_78 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 30 - 256
Target Start/End: Complemental strand, 28764598 - 28764367
Alignment:
| Q |
30 |
gtttactgagtaacacatcaatcacccttgactgccgtagattgatgtacac-----cgattgtagcgaagtagttggttcctgcaatggattgatatgt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28764598 |
gtttactgagtaacacatcaatcacccttgactgccgtagattgatgtacactgattggattgtagcgaagtagttggttcctgtaatggattgatatgt |
28764499 |
T |
|
| Q |
125 |
ttgcttggaaagtccgcaaataaacatcaagccatctggtttcgtgtttggaacccagccacagggaatatatctgaaaaattaggatctttaaacaaac |
224 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28764498 |
ttgcttggacggtccgcaaataagcatcgagccatctggttccgtgtttggaacccagccacagggaatatatctgaaaaattaggatctttaaacaaac |
28764399 |
T |
|
| Q |
225 |
ctcgcaagcgtggatctagcatgctcagatac |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28764398 |
ctcgcaagcgtggatctagcatgctcagatac |
28764367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 127
Target Start/End: Original strand, 3625189 - 3625220
Alignment:
| Q |
96 |
tagttggttcctgcaatggattgatatgtttg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3625189 |
tagttggttcctgcaatggattgatatgtttg |
3625220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 134
Target Start/End: Complemental strand, 18914152 - 18914114
Alignment:
| Q |
96 |
tagttggttcctgcaatggattgatatgtttgcttggaa |
134 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
18914152 |
tagttggttcctgcaatggattgatttgtttgcgtggaa |
18914114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 98 - 127
Target Start/End: Complemental strand, 3561608 - 3561579
Alignment:
| Q |
98 |
gttggttcctgcaatggattgatatgtttg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3561608 |
gttggttcctgcaatggattgatatgtttg |
3561579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 314 times since January 2019
Visitors: 6696