View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_79 (Length: 256)
Name: NF0900_low_79
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_79 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 30 - 256
Target Start/End: Complemental strand, 34053109 - 34052883
Alignment:
| Q |
30 |
cttgcaaccaaagttgcgaaaaacagaagctgttctgacataggaagtaccaatggaccaagtgttgtgatgttggttttgagtgcttctccggcgaccg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
34053109 |
cttgcaaccaaagttgcgaaaaacagaagctgttctgacataggaagtaccaatggaccaagtgttgtgatgttggttttcagtgcttctccggcaaccg |
34053010 |
T |
|
| Q |
130 |
ccattaaatcttttgagagtgatacaccaattgatttcttctcatcttcttcttggaagacacaaccgtatgatctgtcgtccgcgcctttatgtgttcg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34053009 |
ccattaaatcttttgagagtgatacaccaattgatttcttctcatcttcttcttggaagacacaaccatatgatctgtcgtccgcgcctttatgtgttcg |
34052910 |
T |
|
| Q |
230 |
gacggtgtggatcagttggtatttagc |
256 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34052909 |
gacggtgtggatcagttggtatttagc |
34052883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 57 - 253
Target Start/End: Complemental strand, 15239383 - 15239187
Alignment:
| Q |
57 |
agctgttctgacataggaagtaccaatggaccaagtgttgtgatgttggttttgagtgcttctccggcgaccgccattaaatcttttgagagtgatacac |
156 |
Q |
| |
|
|||||||| |||||||| || || ||||| || | |||||||||||| |||||||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
15239383 |
agctgttccgacataggtaggactaatggtcctaatgttgtgatgtttgttttgagtgcttctccggcaacagccattaggtcttttgagagtgatacac |
15239284 |
T |
|
| Q |
157 |
c-aattgatttcttctcatcttcttcttggaagacacaaccgtatgatctgtcgtccgcgcctttatgtgttcggacggtgtggatcagttggtattt |
253 |
Q |
| |
|
| | ||| ||| | || ||||||||||| ||||| || ||||| ||| ||| ||| || ||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
15239283 |
cgacttgcttt-gtgtcgtcttcttcttgaaagacgcagccgtaggatttgttgtctgcacctttgtgcgttcggacggtgtggactagttggtattt |
15239187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 283 times since January 2019
Visitors: 6695