View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_80 (Length: 252)
Name: NF0900_low_80
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_80 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 103 - 234
Target Start/End: Complemental strand, 13590805 - 13590674
Alignment:
| Q |
103 |
tacttatcctaatcttaataatattcagtagaagctcacataaatgaatatacctctgcttatttttatctaaacttcaatcaagataatacaacaattc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13590805 |
tacttatcctaatcttaataatattcagtagaagctcacataaatgaatatacctcagcttatttttatctaaacttcaatcaagataatacaacaattc |
13590706 |
T |
|
| Q |
203 |
attttgggatttaatgggtttgaacatagatc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13590705 |
attttgggatttaatgggtttgaacatagatc |
13590674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 59 times since January 2019
Visitors: 6700