View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0900_low_81 (Length: 250)

Name: NF0900_low_81
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0900_low_81
NF0900_low_81
[»] scaffold0178 (1 HSPs)
scaffold0178 (1-242)||(13524-13762)


Alignment Details
Target: scaffold0178 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0178
Description:

Target: scaffold0178; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 13524 - 13762
Alignment:
1 atgtgtctagtaatccaatggaattgcttagtattcatccggggggttgtgagttttcgaggttttgtgagatgaagtatgagaggcttatccatccttc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||   ||| |||||||| |||||||||||||||||||||||||||||||||||||||||    
13524 atgtgtctagtaatccaatggaattgcttagtattcatccggg---ttgcgagttttcaaggttttgtgagatgaagtatgagaggcttatccatccttc 13620  T
101 aatggagtcgtcgattttcgttaatttggatcagaatgaagcagtgttgaattcgtggaggtcgttgagtatgttctatgaggcgtttgttgggatggct 200  Q
    ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||    
13621 aatggagtcgtcgatcttcgttaatttggatcagaatgaagcggtgttgaattcgtggaggtcgttgagtttgttctacgaggcatttgttgggatggct 13720  T
201 agctcgatatggacactgcataagttgtcacatgcctatgat 242  Q
    ||||||||||||||||||||||||||||||||||||| ||||    
13721 agctcgatatggacactgcataagttgtcacatgcctttgat 13762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University