View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_81 (Length: 250)
Name: NF0900_low_81
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_81 |
 |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0178 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 13524 - 13762
Alignment:
| Q |
1 |
atgtgtctagtaatccaatggaattgcttagtattcatccggggggttgtgagttttcgaggttttgtgagatgaagtatgagaggcttatccatccttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13524 |
atgtgtctagtaatccaatggaattgcttagtattcatccggg---ttgcgagttttcaaggttttgtgagatgaagtatgagaggcttatccatccttc |
13620 |
T |
 |
| Q |
101 |
aatggagtcgtcgattttcgttaatttggatcagaatgaagcagtgttgaattcgtggaggtcgttgagtatgttctatgaggcgtttgttgggatggct |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
13621 |
aatggagtcgtcgatcttcgttaatttggatcagaatgaagcggtgttgaattcgtggaggtcgttgagtttgttctacgaggcatttgttgggatggct |
13720 |
T |
 |
| Q |
201 |
agctcgatatggacactgcataagttgtcacatgcctatgat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13721 |
agctcgatatggacactgcataagttgtcacatgcctttgat |
13762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University