View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_84 (Length: 245)
Name: NF0900_low_84
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 29937755 - 29937652
Alignment:
| Q |
1 |
attgatttcttcgtccaaataatactatacaataatattctcaacaccttccacaggttggttattatgctactagtactatatat--atattaatgttg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29937755 |
attgatttcttcgtccaaataatactatacaataatattctcaacaccttccacaggttggttattatgctactagtactatatatatatattaatgttg |
29937656 |
T |
 |
| Q |
99 |
aaat |
102 |
Q |
| |
|
|||| |
|
|
| T |
29937655 |
aaat |
29937652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University