View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_85 (Length: 241)
Name: NF0900_low_85
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 94 - 216
Target Start/End: Complemental strand, 5394455 - 5394333
Alignment:
Q |
94 |
gatgaaagatatgggtggtgtgtgggaagagattgtgagggaaaatgggttattgcacacaaagcttgaagaagttggagattggtggtttgcagatttt |
193 |
Q |
|
|
|||||| |||| |||||||||||||||||||||||||||||| |||| || ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5394455 |
gatgaaggataagggtggtgtgtgggaagagattgtgagggagaatgaattgttgtacaccaagcttgaagaagttggagattggtggtttgcagatttt |
5394356 |
T |
 |
Q |
194 |
agtttgagactggagggtgtgtt |
216 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
5394355 |
agtttgagactggagggtgtgtt |
5394333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 94 - 216
Target Start/End: Complemental strand, 5390917 - 5390795
Alignment:
Q |
94 |
gatgaaagatatgggtggtgtgtgggaagagattgtgagggaaaatgggttattgcacacaaagcttgaagaagttggagattggtggtttgcagatttt |
193 |
Q |
|
|
|||||| |||| |||||||||||||||||||||||||||||| |||| || ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5390917 |
gatgaaggataagggtggtgtgtgggaagagattgtgagggagaatgaattgttgtacaccaagcttgaagaagttggagattggtggtttgcagatttt |
5390818 |
T |
 |
Q |
194 |
agtttgagactggagggtgtgtt |
216 |
Q |
|
|
| || ||| ||||||||||||| |
|
|
T |
5390817 |
atgtttagagtggagggtgtgtt |
5390795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 94 - 216
Target Start/End: Complemental strand, 5399636 - 5399514
Alignment:
Q |
94 |
gatgaaagatatgggtggtgtgtgggaagagattgtgagggaaaatgggttattgcacacaaagcttgaagaagttggagattggtggtttgcagatttt |
193 |
Q |
|
|
|||||| |||| |||||||||||||||||||||||||||||| |||| || ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5399636 |
gatgaaggataagggtggtgtgtgggaagagattgtgagggagaatgaattgttgtacaccaagcttgaagaagttggagattggtggtttgcagatttt |
5399537 |
T |
 |
Q |
194 |
agtttgagactggagggtgtgtt |
216 |
Q |
|
|
| || ||| ||||||||||||| |
|
|
T |
5399536 |
atgtttagagtggagggtgtgtt |
5399514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University