View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_95 (Length: 218)
Name: NF0900_low_95
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_95 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 72 - 191
Target Start/End: Complemental strand, 10148333 - 10148215
Alignment:
| Q |
72 |
gaataatattgttctgtgtagaaatagattcgattttcttaaataaagtctcaagtttaagttgcgtggatnnnnnnnnnnntagtttaaatgatagatt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10148333 |
gaataatattgttctgtgtagaaatagattcgatttccttaaataaagtctcaagtttaagttgcgtggat-aaaaaaaaaatagtttaaatgatagatt |
10148235 |
T |
 |
| Q |
172 |
ctacttaatacagtgagctt |
191 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
10148234 |
ctactgaatacagtgagctt |
10148215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University