View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0900_low_95 (Length: 218)

Name: NF0900_low_95
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0900_low_95
NF0900_low_95
[»] chr1 (1 HSPs)
chr1 (72-191)||(10148215-10148333)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 72 - 191
Target Start/End: Complemental strand, 10148333 - 10148215
Alignment:
72 gaataatattgttctgtgtagaaatagattcgattttcttaaataaagtctcaagtttaagttgcgtggatnnnnnnnnnnntagtttaaatgatagatt 171  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||           ||||||||||||||||||    
10148333 gaataatattgttctgtgtagaaatagattcgatttccttaaataaagtctcaagtttaagttgcgtggat-aaaaaaaaaatagtttaaatgatagatt 10148235  T
172 ctacttaatacagtgagctt 191  Q
    ||||| ||||||||||||||    
10148234 ctactgaatacagtgagctt 10148215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 124 times since January 2019
Visitors: 6713