View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_98 (Length: 215)
Name: NF0900_low_98
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 27222111 - 27221975
Alignment:
| Q |
1 |
atcaacttctgatttatacctgtcagccttaacttttgatgcttctatctttccaatttctcaattctagaatattttgcatccttatattggtactcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27222111 |
atcaacttctgatttatacctgtcagccttaacttttgatgcttctatctttccaatttctcaattctagaatattttgcatccttatattggtactcac |
27222012 |
T |
 |
| Q |
101 |
ttgaagactatgcatttttcctct-ttttgtcatatt |
136 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
27222011 |
ttgaagactctgcatttttcctcttttttgtcatatt |
27221975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 27226977 - 27226943
Alignment:
| Q |
1 |
atcaacttctgatttatacctgtcagccttaactt |
35 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
27226977 |
atcagcttctgatttatacctgtcagccttaactt |
27226943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University