View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903-Insertion-3 (Length: 78)
Name: NF0903-Insertion-3
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903-Insertion-3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 7 - 78
Target Start/End: Complemental strand, 36239212 - 36239142
Alignment:
| Q |
7 |
aatatcatagtttaaatagttgtgttgaagaatggagcagtgcaacgtaactgagtacctaaggattaattg |
78 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36239212 |
aatatcatagtttaaatagttgt-ttgaagaatggagcaatgcaacgtaactgagtacctaaggattaattg |
36239142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 20969283 - 20969239
Alignment:
| Q |
7 |
aatatcatagtttaaatagttgtgttgaagaatggagcagtgcaac |
52 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
20969283 |
aatatcatagtttaaatagttat-ttgaagaatggagcagtgcaac |
20969239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University