View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_high_17 (Length: 256)
Name: NF0903_high_17
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 47654926 - 47655129
Alignment:
| Q |
25 |
tattatcatatgaagaggttaatgatataactaattaaatggcccaaggtcaaagtataaaaattaaac------tcaagtatcttgtgcctatacattg |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47654926 |
tattatcatatgaagaggttaatgatagaactaattaaatggcccaaggtcaaagtataaaaattaaactcaaactcaagtatcttgtgcctatacattg |
47655025 |
T |
|
| Q |
119 |
aagtaacatggtatgaaatccatacaaaagagtaatgctatatgaacacatatcatagacaacatgcttgttcaccttataaatgcatcattcaccgtat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47655026 |
aagtaacatggtatgaaatccatacaaaagagtaatgctatatgaacatatatcatagacaacatgcttgttcaccttataaatgcatcatttaccgtat |
47655125 |
T |
|
| Q |
219 |
ttat |
222 |
Q |
| |
|
|||| |
|
|
| T |
47655126 |
ttat |
47655129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University