View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_11 (Length: 387)
Name: NF0903_low_11
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 30 - 307
Target Start/End: Original strand, 37657965 - 37658242
Alignment:
| Q |
30 |
aaagagaatcaaaagaagaaaacgctatggctccagattatagaaggatgggaaaacatcattcttcatcgtcagaaatggctggtggaggtgtgatcat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37657965 |
aaagagaatcaaaagaagaaaacgctatggctccagattatagaaggatgggaaaacatcattcttcatcatcagaaatggctggtggaggtgtgatcat |
37658064 |
T |
 |
| Q |
130 |
tggtgggttagttagtgcaacttttgctgttgttttttgctacattcgtgttacaaggaaaaaggatagtgatggtggtggtgttgttgctcattgacat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
37658065 |
tggtgggttagttagtgcaacttttgctgttgttttttgctacattcgtgttacaaggaaaaaggatagtgatggtggtggtggtgttgctcattgatat |
37658164 |
T |
 |
| Q |
230 |
gctctgtttcaactattttgtttctttatgtatacattttagtctaggaactaggaagaaaatggtgtaattcacaag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658165 |
gctctgtttcaactattttgtttctttatgtatacattttagtctaggaactaggaagaaaatggtgtaattcacaag |
37658242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University