View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_15 (Length: 369)
Name: NF0903_low_15
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 3e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 33360980 - 33360744
Alignment:
| Q |
1 |
tcccacaacacaactcacatagcctcactccctctaaatcatacatatcaactaaacagcatcactaatttcacatgtgggtcccaacattgccaaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33360980 |
tcccacaacacaactcacatagcctcactccctctaaatcatacatatcaacaaaacagcatcactaatttcacatgtgggtcccaacattgccaaggtt |
33360881 |
T |
 |
| Q |
101 |
ttaaatttcagttgcagccatgatccttgattaggttgatgctgctgcaattgcgattcatattttacagcatcactaacatcgaatccctaaattttac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | || ||| ||||||||||||||||||||||| |
|
|
| T |
33360880 |
ttaaatttcagttgcagccatgatccttgattaggttgatgctgctgcaattgcga-tcgca----actgca-----aacatcgaatccctaaattttac |
33360791 |
T |
 |
| Q |
201 |
agccacaatcacagcctctaaatcatatttaaaaccattcatattct |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33360790 |
agccacaatcacagcctctatatcatatttaaaaccattcatattct |
33360744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 292 - 364
Target Start/End: Complemental strand, 24129976 - 24129904
Alignment:
| Q |
292 |
agatcaaaatcaagactgatagtattaccattattgctgtcaaattcggcttacacttaaaattgactaatat |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24129976 |
agatcaaaatcaagactgatagtattaccattattgctgtcaaattcggcttacacttaaaattgactaatat |
24129904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University