View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_23 (Length: 327)
Name: NF0903_low_23
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 81 - 252
Target Start/End: Original strand, 30218656 - 30218827
Alignment:
| Q |
81 |
gacatcatcaaattgaggagcaacttgcgacggatttcctgtgcatggtaaacttcacgaagaaaaattgcatgttcataaactccatgaattccaaaag |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30218656 |
gacatcatcaaattgaggagcaacttgcgacggatttcctgtgcatggtaaacttcacgaagaaaaattgcatgttcataaactccatgaattccaaaag |
30218755 |
T |
 |
| Q |
181 |
tggtgggttgtgctcctagtgcaattactaacttatcataggagattgtaaacttccaaggatccagtgtct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30218756 |
tggtgggttgtgctcctagtgcaattactaacttatcataggagattgtaaacttccaaggatccagtgtct |
30218827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 86 - 241
Target Start/End: Original strand, 25867188 - 25867343
Alignment:
| Q |
86 |
catcaaattgaggagcaacttgcgacggatttcctgtgcatggtaaacttcacgaagaaaaattgcatgttcataaactccatgaattccaaaagtggtg |
185 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||||||||||| | ||||| ||||||||||| |||||||||| ||||| |||||||||||||| | |
|
|
| T |
25867188 |
catcaaatttaggagcaacttccgacgaatttcctgtgcatgatgtacttcgcgaagaaaaatggcatgttcattgactccttgaattccaaaagtagaa |
25867287 |
T |
 |
| Q |
186 |
ggttgtgctcctagtgcaattactaacttatcataggagattgtaaacttccaagg |
241 |
Q |
| |
|
|| |||| ||||||||||||||||| ||||||||| |||| |||||| |||||||| |
|
|
| T |
25867288 |
ggatgtgatcctagtgcaattactagcttatcatatgagactgtaaatttccaagg |
25867343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University