View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_28 (Length: 312)
Name: NF0903_low_28
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0903_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 30742063 - 30742005
Alignment:
Q |
121 |
tgccaacaaatgctagtattaactcgagacaatgagtgcatctcttgagtaataccaca |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30742063 |
tgccaacaaatgctagtattaactcgagacaatgagtgcatctcttgagtaataccaca |
30742005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 17109701 - 17109644
Alignment:
Q |
121 |
tgccaacaaatgctagtattaactcgagacaatgagtgcatctcttgagtaataccac |
178 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||| ||||| | ||| ||||||| |
|
|
T |
17109701 |
tgccaacaaattatagtattaacacgagacaatgagtgaatctcattagtgataccac |
17109644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University