View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_3 (Length: 552)
Name: NF0903_low_3
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 5e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 211 - 374
Target Start/End: Complemental strand, 48082566 - 48082403
Alignment:
| Q |
211 |
ctctgtaactgttatagtagtattgtcttacctcttacattaatgtgagaacgagagagtagatatacataagtgtagatctaaaaacagttgacgtcaa |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48082566 |
ctctgtaactgttatagtagtattgtcttacctcttacattaatgtgagaacgagagagtagataaacataagtgtagatctaaaaacagttgacgtcaa |
48082467 |
T |
|
| Q |
311 |
tgtgttcaaaaatagctaggagggctgttattatatgtacatttgaggcaaatagaatggtaga |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48082466 |
tgtgttcaaaaatagctaggagggctgttattatatgtacatttgaggcaaatagaatggtaga |
48082403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University