View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_32 (Length: 277)
Name: NF0903_low_32
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 29 - 267
Target Start/End: Original strand, 46493590 - 46493840
Alignment:
| Q |
29 |
agatcagtggtccagtagtccgacctgtaagcatgctcttgattacctgttctgagctatctttggcaatttcagcttccattttccctagttcctgtta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46493590 |
agatcagtggtccagtagtccgacctgtaagcatgctcttgattacctgttctgagctatctttggcaatttcagcttccattttccctagttcctgtta |
46493689 |
T |
|
| Q |
129 |
tatagattggagttggattacacaggattgaattattcgatata------------acttatatttaacaatgatagattagatcaatggaatggtctaa |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46493690 |
tatagattggagttggattgcacaggattgaattattcgatataattactactaacatttatatttaacaatgatagattagatcaatggaatggtctaa |
46493789 |
T |
|
| Q |
217 |
tccattagatcaacaactgattactataattaacatatgcaataacctttg |
267 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46493790 |
tccattagatcaacaactgattaccataattaacatatgcaataacctttg |
46493840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 46484230 - 46484280
Alignment:
| Q |
89 |
ctttggcaatttcagcttccattttccctagttcctgttatatagattgga |
139 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
46484230 |
ctttagcaatttcagcttccattttccctggttcctgtcatatggattgga |
46484280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University