View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_35 (Length: 265)
Name: NF0903_low_35
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 26 - 212
Target Start/End: Original strand, 31946027 - 31946213
Alignment:
| Q |
26 |
ataggtacaaaatattaaccgccatttagaagcgacaatataaaacttgttgaacacataagattaattcttctctttcagtcgaattttctttgtatac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31946027 |
ataggtacaaaatattaaccgccatttagaagcgacaatataaaacttgtagaacacataagattaattcttctctttcagtcgaattttctttgtatgc |
31946126 |
T |
|
| Q |
126 |
aagagctcgagacggatcttatgtccaccaggatgagaaacattaaatatatcaaacattgacagattaaaagggtttgcaaattga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31946127 |
aagagctcgagacggatcttatgtccaccaggatgagaaacattaaatatatcaaacatagacatgttaaaagggtttgcaaattga |
31946213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University