View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_38 (Length: 253)
Name: NF0903_low_38
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 66 - 228
Target Start/End: Complemental strand, 3811369 - 3811207
Alignment:
| Q |
66 |
ttggtatatagttggtcatcacatagctacataatgtgaatgtatgaattttccctttgcaccatgttttttaacctctctgcaaatagagcagaggtca |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3811369 |
ttggtatatagttggtcatcacatagctacataatgtgaatgtatgaattttccctttgcaccatgttttttaacctctctgcaaatagagcagagatca |
3811270 |
T |
|
| Q |
166 |
agtttatttatttatttcaaaaagaacaaaataattagacaatgagtacaagtgagatttgat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3811269 |
agtttatttatttatttcaaaaagaacaaaataattaaacaatgagtacaagtgagatttgat |
3811207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 3811492 - 3811426
Alignment:
| Q |
1 |
ccaaatcaactcgccctcattcttttcagtacaacttaaagttcgaggctagagcaatagaatcgttg |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
3811492 |
ccaaatcaactcgccctcattcttttcagtacaactt-aagttcgaggctagagcaataaaatcgttg |
3811426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University