View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_43 (Length: 233)
Name: NF0903_low_43
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0903_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 20 - 147
Target Start/End: Complemental strand, 16645312 - 16645185
Alignment:
| Q |
20 |
aggtcttaatcttgatttaagttcttcaatatcctaacatagaggctaaaataaatgatggataatcataggcaaacacttgggaattttgcaatggtag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645312 |
aggtcttaatcttgatttaagttcttcaatatcctaacatagaggctaaaaaaaatgatggataatcataggcaaacacttgggaattttgcaatggtag |
16645213 |
T |
 |
| Q |
120 |
cattactctttcttggttttattttcat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
16645212 |
cattactctttcttggttttattttcat |
16645185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 27 - 145
Target Start/End: Complemental strand, 1520961 - 1520838
Alignment:
| Q |
27 |
aatcttgatttaagttcttcaatatcctaacatagaggctaaaataaa-----tgatggataatcataggcaaacacttgggaattttgcaatggtagca |
121 |
Q |
| |
|
||||||||||||| || | ||||||||||||||||||| || | ||| |||||||||||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
1520961 |
aatcttgatttaatttgtacaatatcctaacatagaggtaaagaaaaaaataatgatggataatcttaggcaaacccttgggagttttgcaatggtagca |
1520862 |
T |
 |
| Q |
122 |
ttactctttcttggttttattttc |
145 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
1520861 |
ttactctttattggttttattttc |
1520838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 27 - 145
Target Start/End: Complemental strand, 1516776 - 1516652
Alignment:
| Q |
27 |
aatcttgatttaagttcttcaatatcctaa-catagaggctaaaata-----aatgatggataatcataggcaaacacttgggaattttgcaatggtagc |
120 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||||||| || ||| ||||||||||| || ||||||||||||||||| ||||||||||||||| |
|
|
| T |
1516776 |
aatcttgatttaatttgttcaatatcctaaacatagaggtaaatatagaattaatgatggatagtcttaggcaaacacttgggagttttgcaatggtagc |
1516677 |
T |
 |
| Q |
121 |
attactctttcttggttttattttc |
145 |
Q |
| |
|
|||||||||| || ||||||||||| |
|
|
| T |
1516676 |
attactctttgttagttttattttc |
1516652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 145
Target Start/End: Original strand, 23087298 - 23087344
Alignment:
| Q |
99 |
ttgggaattttgcaatggtagcattactctttcttggttttattttc |
145 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
23087298 |
ttgggtattttgcaatggtagcattgctctttggtggttttattttc |
23087344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University