View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0903_low_53 (Length: 205)
Name: NF0903_low_53
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0903_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 2 - 88
Target Start/End: Original strand, 40809908 - 40809994
Alignment:
Q |
2 |
ttgctgaaacaacaacaacatgctccctacatcccagttcccttctcccttgattctcagtttcagattaactcaattattgtcctt |
88 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40809908 |
ttgctgaaacaacaacaacatgctccctacatcccagttcccttctcccttgattctcagtttcagattaactcaattattgtcctt |
40809994 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University