View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0904-INSERTION-11 (Length: 186)
Name: NF0904-INSERTION-11
Description: NF0904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0904-INSERTION-11 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 7 - 186
Target Start/End: Complemental strand, 9884731 - 9884552
Alignment:
Q |
7 |
acctatgtcattttaatcttgtctcaccataccaatattttttacttttcttcttcaggcactataagtatgttcatgcttctcatgataattggtagaa |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
9884731 |
acctatgtcattttaatcttgtctcaccataccaacattttttacttttcttcttcaggcactataagtatgttcatgcctctcatgataattggtagaa |
9884632 |
T |
 |
Q |
107 |
gcacttatagattcctcaaaatccagcacacattcatctttagttgagtattgataccactattcagggtttagtattat |
186 |
Q |
|
|
||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
9884631 |
gcacttatagattcctcaagatccagcacgcatgcatctttagttgagtattgataccactatccagggtttagtattat |
9884552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University