View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0904-INSERTION-22 (Length: 260)
Name: NF0904-INSERTION-22
Description: NF0904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0904-INSERTION-22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 47127094 - 47126851
Alignment:
| Q |
8 |
agatgagaattacnttgnaaaatataaaattaacacatgtatattatagaactttgcacctgaaaacccagcttttaataaatttggtcgcctatgttga |
107 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127094 |
agatgagaattacattggaaaatataaaattaacacatgtatattatagaactttgcacctgaaaacccagcttttaataaatttggtcgcctatgttga |
47126995 |
T |
|
| Q |
108 |
gccagtgcaattgccaatgcttcctctacctataaaaaatattacaatgaatatattgatttgggaaagacctcttttgtgcttcttggttactaccaat |
207 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126994 |
gccaatgcaattgccaatgcttcctctacctataaaaaaaattacaatgaatatattgatttgggaaagacctcttttgtgcttcttggttactaccaat |
47126895 |
T |
|
| Q |
208 |
tgcgactgataaatgaacacaatacacaaggattttattttctt |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
47126894 |
tgcgactggtaaatgaacacaatacacaatgattttattttctt |
47126851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 136 times since January 2019
Visitors: 6695