View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0904-INSERTION-24 (Length: 187)
Name: NF0904-INSERTION-24
Description: NF0904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0904-INSERTION-24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 8 - 175
Target Start/End: Complemental strand, 6064087 - 6063920
Alignment:
| Q |
8 |
tcaatgaccacttctattgggacctcaaacaaaatgtgtatatgtgggttaaatagaagccaaatcactgacccatcagcaatcacttgttttatttagt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6064087 |
tcaatgaccacttctattgggacctcaaacaaaatgtgtatatgtgggttaaatagaagccaaatcactaacccatcagcaatcacttgttttatttagt |
6063988 |
T |
 |
| Q |
108 |
agggttaggtacttgataatcaaagtatattattaagccatggtaatgacgacttcaacagtataatc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6063987 |
agggttaggtacttgataatcaaagtatattattaagccatggtaatgacgacttcaacagtataatc |
6063920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University