View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0904-INSERTION-28 (Length: 223)
Name: NF0904-INSERTION-28
Description: NF0904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0904-INSERTION-28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 30629502 - 30629724
Alignment:
| Q |
1 |
gtattcaacttctagtttgaaggtgcttatgagtttatgctttcttccgattttgtgttgtaaattaaacattttaattttatgctatggttataatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30629502 |
gtattcaacttctagtttgaaggtgcttatgagtttatgctttcttccgattttgtgttgtatattaaacattttaattttatgatatggttataatgta |
30629601 |
T |
|
| Q |
101 |
gattagggaccaatttgtgattggtttgagacttgagtggtaaggaactcgagtactttaaacaagtggtcagaagtttgatttgtgactcttgtatttg |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30629602 |
gattagggaccaacttgtgattggtttgagatttgagtggtaaggaactcgagtactttaaacaagtggtcagaagtttgatttacgactcttgtatttg |
30629701 |
T |
|
| Q |
201 |
aagaaaatctagttggaagagaa |
223 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
30629702 |
aagaaaatctaattggaagagaa |
30629724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 189
Target Start/End: Original strand, 34329597 - 34329631
Alignment:
| Q |
155 |
actttaaacaagtggtcagaagtttgatttgtgac |
189 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
34329597 |
actttaaacaagtggtcagatgtttgatttgtgac |
34329631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 281 times since January 2019
Visitors: 6695