View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0904-INSERTION-30 (Length: 255)
Name: NF0904-INSERTION-30
Description: NF0904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0904-INSERTION-30 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 7e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 7e-74
Query Start/End: Original strand, 114 - 255
Target Start/End: Original strand, 16087433 - 16087574
Alignment:
| Q |
114 |
aataagcaccaaggattaaagacataagaaaatagctcaaaacaatattacatgaatcactacttcagctcatgatgattaagtttaaartattctaact |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16087433 |
aataagcaccaaggattaaagacataagaaaatagctcaaaacaatattacatgaatcactacttcagctcatgatgattaagtttaaagtattctaact |
16087532 |
T |
|
| Q |
214 |
tctaagatgctatcatagttctcatttatacacacacaaaat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16087533 |
tctaagatgctatcatagttctcatttatacacacacaaaat |
16087574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 16087389 - 16087434
Alignment:
| Q |
1 |
gactcaagattttagaaagtcaaaatcgcacactctcatactctaa |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16087389 |
gactcaagattttagaaagtcaaaatcgcacactctcatactctaa |
16087434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 53838100 - 53838144
Alignment:
| Q |
188 |
atgattaagtttaaartattctaacttctaagatgctatcatagt |
232 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
53838100 |
atgattaagcttaaggtattctaacttctaagatgctatcatagt |
53838144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 98 times since January 2019
Visitors: 6695