View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0904-INSERTION-32 (Length: 499)
Name: NF0904-INSERTION-32
Description: NF0904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0904-INSERTION-32 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 246 - 499
Target Start/End: Complemental strand, 31651214 - 31650961
Alignment:
| Q |
246 |
gaatttgtaaaggcagttgttgcttatcagaagaggctgaatacctctgtgcaaaagcctctaaaacttaataaggaaatggaaaacaaaaggaaaagta |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31651214 |
gaatttgtaaaggcagttgttgcttatcagaagaggctgaatacctctgtgcaaaagcctctaaaacttaataaggaaatggaaaacaaaaggaaaagta |
31651115 |
T |
 |
| Q |
346 |
tagtgcgtagtttctcacttgcaaaagacctctacaatcatggccttggtatgagctccaccaaagaatctgagcttcaagaaggggcagagtttctaga |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31651114 |
tagtgcgtagtttctcacttgcaaaagacctctacaatcatggccttggtatgagctccaccaaagaatctgagcttcaagaaggggcagagtttctaga |
31651015 |
T |
 |
| Q |
446 |
ggtaatgcactatcacaatttctcagttgttcaagttactttttatgtagcacc |
499 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31651014 |
ggtaatgcactatcacaatatctcagttgttcaagttactttttatgtagcacc |
31650961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 32 - 252
Target Start/End: Complemental strand, 31650923 - 31650704
Alignment:
| Q |
32 |
cgagtcagtgtctggtgtctgtattcataagttaattcatgacgtgctgcatcatatgaatgcgatagtctt-ttttggcttaattacacttttggtctc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
31650923 |
cgagtcagtgtctggtgtctgtattcataagttaattcatgacgtgctgcatcatatgaatgcgatagtcttttttttgcttaattacacttttagtctc |
31650824 |
T |
 |
| Q |
131 |
tatagttaagagtttttctattttgtcccctctagattttccgaccgattttagtacctccatccaattatatttcacatagatcctttaatgtattgaa |
230 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
31650823 |
tatagtt-agagttttgctattttgtcccctctagattttctgaccgattttagtacctccat-cgattatatttcacataaatcctttaatgtattgaa |
31650726 |
T |
 |
| Q |
231 |
atatttatgtgtattgaatttg |
252 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31650725 |
atatttatgtgtattgaatttg |
31650704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 31650965 - 31650923
Alignment:
| Q |
1 |
gcaccgacagaatgcatgtctagtgtccgaacgagtcagtgtc |
43 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31650965 |
gcaccgacagaatatttgtctagtgtccgaacgagtcagtgtc |
31650923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University