View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0904-INSERTION-4 (Length: 259)
Name: NF0904-INSERTION-4
Description: NF0904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0904-INSERTION-4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 979113 - 978859
Alignment:
| Q |
1 |
tcttcaccttgacccaagattaatcccctcttcttgatttctgaggtttttcctttgcttttgtttgggtccccctggtgctagaatcttttatctcctg |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
979113 |
tcttcaccttgacccaagattaatcttctcttcttgatttttgaggtttttcctttgcttctgtttgggtccacctggtgctagaatcttttatctcctg |
979014 |
T |
|
| Q |
101 |
ggttgttatatgtgtttctttctttcagttgtactctacaagaattattgatttctttatcagagcgtattcaccttttctttttctatgtgcttttgtc |
200 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
979013 |
ggttcttatatgtgtctctttctttcagttgtactctacaagaattattgatttctttatcataatgtattcaccttttctttttctctgtgcttttgtc |
978914 |
T |
|
| Q |
201 |
tgttaccctacataaac---cttggtttcttctagatttcatctttctctatatt |
252 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
978913 |
tgttaccctacagaaaccttcttggtttcttctagatttcatttttctctatatt |
978859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 165 times since January 2019
Visitors: 6695