View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_high_1 (Length: 548)
Name: NF0905_high_1
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_high_1 |
 | |
|
| [»] scaffold0223 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 3e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 50872257 - 50872474
Alignment:
| Q |
30 |
tgttatacataaagaaaatccacaagggaattattttggaactttaaataaataccaagagaagaaaaaataatagactgaagaaatgccttgcattcaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50872257 |
tgttatacataaagaaaatccacaagggaattattttggaactttaaataaataccaagagaagaaaaaataatagactgaagaaatgccttgcattcaa |
50872356 |
T |
|
| Q |
130 |
tgcacaaagcatgcaaaattttcactcatgacaagacatnnnnnnnnnnnnnnnnnnnnnncacttgtttagtaccttgtcttcctaattcacctctcat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50872357 |
tgcacaaagcatgcaaaattttcactcatgacaagacat-----gaaaagaaaagaaaaaacacttgtttagtaccttgtcttcctaattcacctctcat |
50872451 |
T |
|
| Q |
230 |
gcttctatacatctggttatcat |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50872452 |
gcttctatacatctggttatcat |
50872474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 328 - 423
Target Start/End: Original strand, 50872545 - 50872640
Alignment:
| Q |
328 |
cctgaagatggctcttgacatgtgaaatagtgagtcctttgatatccatcaactgaagaacaagtttaggagtagcctctgccaaaaatacaaagt |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50872545 |
cctgaagatggctcttgacatgtgaaatagtgagtcctttgatatccatcaactgaagaacaagtttaggagtagcctctgccaaaaatacaaagt |
50872640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 49; Significance: 9e-19; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 335 - 407
Target Start/End: Original strand, 21147 - 21219
Alignment:
| Q |
335 |
atggctcttgacatgtgaaatagtgagtcctttgatatccatcaactgaagaacaagtttaggagtagcctct |
407 |
Q |
| |
|
||||||||| ||||||||||| || || ||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21147 |
atggctcttaacatgtgaaattgttagccctttaacatccatcaactgaagaacaagtttaggagtagcctct |
21219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 175 times since January 2019
Visitors: 6695