View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_high_11 (Length: 347)
Name: NF0905_high_11
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 31980632 - 31980881
Alignment:
| Q |
1 |
ccccggtagctctaactcattaattgaatatacaaacacaaattgcattcaacattcttcggtaccaccgatggataagtccaatagtactgagcgtgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
31980632 |
ccccggtagctctaactcattaattgaatatacaaacacagattgcattcaacattcttcggtaccactgatggataagtccaatagtactaagcgtgag |
31980731 |
T |
 |
| Q |
101 |
aagaaacaagagaaagagaaagaggaggttttgttcaacggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaagatcgatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980732 |
aagaaacaagagaaagagaaagaggaggttttgttcaatggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaagatcgatgc |
31980831 |
T |
 |
| Q |
201 |
aagagatggtggaggcgcgaccggagttgatggatgtgaaatcaaattgg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980832 |
aagagatggtggaggcgcgaccggagttgatggatgtgaaatcaaattgg |
31980881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 134 - 232
Target Start/End: Complemental strand, 38042481 - 38042383
Alignment:
| Q |
134 |
ttcaacggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaagatcgatgcaagagatggtggaggcgcgaccggagttgatg |
232 |
Q |
| |
|
||||||||||||||||| || ||||| || || || || ||||| ||||||||| |||| || ||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
38042481 |
ttcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatg |
38042383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University