View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_high_19 (Length: 277)
Name: NF0905_high_19
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 30 - 272
Target Start/End: Original strand, 23893748 - 23893990
Alignment:
| Q |
30 |
ccttcattccatcattcattagccgtccacatatatttaggatatgatcactatttggatttggatataagtgcaagatccaattgcactaacttgtatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23893748 |
ccttcattccatcattcattagccgtccacatatatttaggatatgatcactatttggatttggatataagtgcaagatccaattgcactaacttgtatt |
23893847 |
T |
|
| Q |
130 |
ctattgtgttttgattcattgtactttatatcaactacaccgacgaaacttatttggaatcgctgtgattttgtaaaagctatactttgtaaattgtagc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23893848 |
ctattgtgttttgattcattgtactttatatcaactacaccgacgaaacttatttggattcgctgtgattttgtaaaagctatactttgtaaattgtagc |
23893947 |
T |
|
| Q |
230 |
ttaaacaaaatcatggtgtcatcgtgactttgttcatctcact |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
23893948 |
ttaaacaaaatcatggtgtcatcgtgactttgtttaactcact |
23893990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 133 times since January 2019
Visitors: 6702