View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_high_22 (Length: 273)
Name: NF0905_high_22
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0905_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 244
Target Start/End: Original strand, 34879365 - 34879606
Alignment:
Q |
11 |
gatgaagctgaggaaattgtgccagatgaagatgaagaggaagaacccaagttggaattggatcttggccctcagttttctcttaaggaacaacttgaga |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34879365 |
gatgaagctgaggaaattgtgccagatgaagatgaagaggaagaacccaagttggaattggatcttggccctcagttttctcttaaggaacaacttgaga |
34879464 |
T |
 |
Q |
111 |
aagataaagtaaggttttcttttgaaatggtttctgaatttattttatttgtctctagtag--------tgnnnnnnngatgcattggaaattttgtttt |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
T |
34879465 |
aagataaagtaaggttttcttttgaaatggtttctgaatttattttatttgtctctagtagttttttttttttttttttatgcattggaaattttgtttt |
34879564 |
T |
 |
Q |
203 |
gtattttaaaggatgatgaaagcttgaggaaatggaaagaac |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34879565 |
gtattttaaaggatgatgaaagcttgaggaaatggaaagaac |
34879606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 38371827 - 38371772
Alignment:
Q |
65 |
gaattggatcttggccctcagttttctcttaaggaacaacttgagaaagataaagt |
120 |
Q |
|
|
|||||||||||||| ||||| ||| | || |||||||| ||||||||||||||||| |
|
|
T |
38371827 |
gaattggatcttggtcctcaatttaccctcaaggaacagcttgagaaagataaagt |
38371772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University