View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_high_24 (Length: 251)
Name: NF0905_high_24
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0905_high_24 |
 |  |
|
[»] scaffold0280 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0280 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 10374 - 10153
Alignment:
Q |
30 |
aagggcacttgaaatctgaagcaagagatcctctttcccataattattgattccaataacaacatcatggtcaggatgcgccgaaattatatcaattgcc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10374 |
aagggcacttgaaatctgaagcaagagatcctctttcccataattattgattccaataacaacatcatggtcaggatgcgccgaaattatatcaattgcc |
10275 |
T |
 |
Q |
130 |
tgaaatcagacatcagccaagtcaaaataaaacatccgtaaaaattaagggggatatgtgtcgttagtgtaaattagtcttgtaacgacaacgctatgtg |
229 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| | |
|
|
T |
10274 |
tgaaatcagacatcaaccaagtcaaaataaaacatccgtaaaaattaagggggatatgtgtcgttagtgtaaactagtcttgtaacaacaacgctatgag |
10175 |
T |
 |
Q |
230 |
aatcaagtaattgacagttact |
251 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
10174 |
aatcaagtaattgacagttact |
10153 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 37 - 164
Target Start/End: Complemental strand, 21915203 - 21915076
Alignment:
Q |
37 |
cttgaaatctgaagcaagagatcctctttcccataattattgattccaataacaacatcatggtcaggatgcgccgaaattatatcaattgcctgaaatc |
136 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| | ||||||||||||||| ||||||||| |
|
|
T |
21915203 |
cttgaaatctgaagcaagagatcttctttcccataattattgattccgataataacatcatggtcaggatgagatgaaattatatcaattacctgaaatc |
21915104 |
T |
 |
Q |
137 |
agacatcagccaagtcaaaataaaacat |
164 |
Q |
|
|
|||||||| ||||||||||| ||||||| |
|
|
T |
21915103 |
agacatcaaccaagtcaaaagaaaacat |
21915076 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University