View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_high_25 (Length: 251)
Name: NF0905_high_25
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_high_25 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 3 - 251
Target Start/End: Complemental strand, 45946690 - 45946442
Alignment:
| Q |
3 |
tggagtatcatagggattagttgttagaagttccaggtgacctgtggatcgtggtcccattaccttttcaactatcattcctcctttgaatttgaaaatt |
102 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45946690 |
tggattatcattgggattagttgttagaagttccaggtgacctgtggatcgtggtcccattaccttttcaactatcattcctcctttgaatttgaaaatt |
45946591 |
T |
|
| Q |
103 |
ggattggctaatgatctaattatgtctgcaaaactttccatagtttctggtctaaacttggaggatataccactcttaaaacaagaagaaaataaaattc |
202 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45946590 |
ggattggttaatgatctaattatgtctgcaaaactttccatagtttctggtctaaacttggaggatataccactcttaaaacaagaagaaaataaaattc |
45946491 |
T |
|
| Q |
203 |
aagattaagtttcatgtcatgatataaaagtatataaaagtaagattct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45946490 |
aagattaagtttcatgtcatgatataaaagtatataaaagtaagattct |
45946442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 93 - 159
Target Start/End: Complemental strand, 45939512 - 45939446
Alignment:
| Q |
93 |
tttgaaaattggattggctaatgatctaattatgtctgcaaaactttccatagtttctggtctaaac |
159 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||| ||||||| | ||||||| ||||| |
|
|
| T |
45939512 |
tttgagaattggattggctaatgatctaattgtgtctgcaaaaatttccatggcttctggtgtaaac |
45939446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 452 times since January 2019
Visitors: 6696