View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0905_high_27 (Length: 214)

Name: NF0905_high_27
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0905_high_27
NF0905_high_27
[»] chr2 (2 HSPs)
chr2 (29-100)||(35850794-35850865)
chr2 (34-90)||(35841182-35841238)


Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 29 - 100
Target Start/End: Original strand, 35850794 - 35850865
Alignment:
29 acaggaatccctagaatcatcgtccatcacatcttgtgattcctcttgatcttccacattcatatcactcga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||    
35850794 acaggaatccctagaatcatcgtccatcacatcttgtgattcctcttgatcttccacattcaattcactcga 35850865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 90
Target Start/End: Original strand, 35841182 - 35841238
Alignment:
34 aatccctagaatcatcgtccatcacatcttgtgattcctcttgatcttccacattca 90  Q
    |||||||||||||||||||||| |||||| |||| ||||||||||||||| ||||||    
35841182 aatccctagaatcatcgtccataacatctcgtgaatcctcttgatcttccgcattca 35841238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 454 times since January 2019
Visitors: 6703