View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_high_27 (Length: 214)
Name: NF0905_high_27
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 29 - 100
Target Start/End: Original strand, 35850794 - 35850865
Alignment:
| Q |
29 |
acaggaatccctagaatcatcgtccatcacatcttgtgattcctcttgatcttccacattcatatcactcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35850794 |
acaggaatccctagaatcatcgtccatcacatcttgtgattcctcttgatcttccacattcaattcactcga |
35850865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 90
Target Start/End: Original strand, 35841182 - 35841238
Alignment:
| Q |
34 |
aatccctagaatcatcgtccatcacatcttgtgattcctcttgatcttccacattca |
90 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| ||||||||||||||| |||||| |
|
|
| T |
35841182 |
aatccctagaatcatcgtccataacatctcgtgaatcctcttgatcttccgcattca |
35841238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 454 times since January 2019
Visitors: 6703