View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_19 (Length: 347)
Name: NF0905_low_19
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 31980656 - 31980398
Alignment:
| Q |
1 |
aattaatgagttagagctaccgggggaggagaagaagaagcgttgagaggcgaaggctgctgcaaaatctgctggctcaggttcgggttcaatttcgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980656 |
aattaatgagttagagctaccgggggaggagaagaagaagcgttgagaggcgaaggctgctgcaaaatctgctggctcaggttcgggttcaatttcgaga |
31980557 |
T |
|
| Q |
101 |
tcgaaagaggttgatgtagtgaaggtggtagagagtgaagaagagcataaagtgtggtcagaggttaaggaagggtcatagagagagttgaaattcttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980556 |
tcgaaagaggttgatgtagtgaaggtggtagagagtgaagaagagcataaagtgtggtcagaggttaaggaagggtcatagagagagttgaaattcttga |
31980457 |
T |
|
| Q |
201 |
tcataattgatggggaaggtgtagatgaagaaggcttttgaagaatttgatgatgatgt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980456 |
tcataattgatggggaaggtgtagatgaagaaggcttttgaagaatttgatgatgatgt |
31980398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 708 times since January 2019
Visitors: 6696