View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_33 (Length: 305)
Name: NF0905_low_33
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0905_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 81 - 198
Target Start/End: Original strand, 32131668 - 32131783
Alignment:
Q |
81 |
tcaaacctgtgcaaagttcgatgccacaactttaaactaaagataaaatgtgatactttcaaaataagcacataagtaagcatattccaagtgtgttatt |
180 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
32131668 |
tcaaacctgtgcaaagttcgatgccacaactttaaactaaagataaaatgtgatactttcaaaataagcacataagt--gcatattccaagtgtgttatt |
32131765 |
T |
 |
Q |
181 |
acttttaacttggggttc |
198 |
Q |
|
|
| |||||||||||||||| |
|
|
T |
32131766 |
atttttaacttggggttc |
32131783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 240
Target Start/End: Complemental strand, 34879412 - 34879365
Alignment:
Q |
193 |
gggttcttcctcttcatcttcatctggcacaatttcctcagcttcatc |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34879412 |
gggttcttcctcttcatcttcatctggcacaatttcctcagcttcatc |
34879365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University