View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_38 (Length: 290)
Name: NF0905_low_38
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 96 - 241
Target Start/End: Complemental strand, 40311867 - 40311721
Alignment:
| Q |
96 |
tttgtattgcacgcatatcgatttctcaaaacagagctttcttttttagttcaattcatttacgtaattgtccttgttgtttgtttctaatgacatg-tt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40311867 |
tttgtattgcacgcatatcgatttctcaaaacagagctttcttttttagttcaattcatttacgtaattgtccttgttgtttgtttctaatgacatgttt |
40311768 |
T |
|
| Q |
195 |
acatagccctacactactcatgtcattttcaacgttcaccacctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40311767 |
acatagccctacactactcatgtcattttcaacattcaccacctttg |
40311721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 743 times since January 2019
Visitors: 6705