View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_53 (Length: 265)
Name: NF0905_low_53
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0905_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 30767813 - 30767675
Alignment:
Q |
1 |
aactcacagtcatttctaggccaaggttccggttcagaatactctccaaacgagacccttcagtcaaatttttcgcattctgttagaacatggaatgaga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30767813 |
aactcacagtcatttctaggccaaggttccggttcagaatactctccaaacgagacccttcagtcaaatttttcgcattctgttagaacatggaatgaga |
30767714 |
T |
 |
Q |
101 |
ttcctatggattcttcttcagaggttcatcatcacaggt |
139 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30767713 |
ttcctatggattcttcttcagaggttcatcatcacaggt |
30767675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 145 times since January 2019
Visitors: 6702