View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_58 (Length: 228)
Name: NF0905_low_58
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0905_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 36239316 - 36239207
Alignment:
Q |
4 |
tatagttgtaaattacatatatcaaaaaactttatgaataggtatgtgaacatgatggccactacaaaggggtgaggcacacttttctcagccacatata |
103 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36239316 |
tatagttgtaaattacatatatcaacaaactttatgaataggtatgtgaacatgatggccactacaaaggggtgaggcacacttttctcagccacatata |
36239217 |
T |
 |
Q |
104 |
atgtaatatc |
113 |
Q |
|
|
|||||||||| |
|
|
T |
36239216 |
atgtaatatc |
36239207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 739 times since January 2019
Visitors: 6696