View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0905_low_60 (Length: 218)

Name: NF0905_low_60
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0905_low_60
NF0905_low_60
[»] chr5 (1 HSPs)
chr5 (131-203)||(30355678-30355750)


Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 131 - 203
Target Start/End: Original strand, 30355678 - 30355750
Alignment:
131 ctagttatccaaaagggtatgtgaaacggatgttgtcatgtctagtgacgttctcgttcttagattctttgat 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30355678 ctagttatccaaaagggtatgtgaaacggatgttgtcatgtctagtgacgttctcgttcttagattctttgat 30355750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 726 times since January 2019
Visitors: 6696