View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_63 (Length: 211)
Name: NF0905_low_63
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 11779016 - 11778955
Alignment:
| Q |
1 |
atatgacatcctctctgct-cctccacacctaaattaacattcacaattcatttcaattatc |
61 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
11779016 |
atatgacatcctctctgccacctccacacctaaattaacattcacaatttatttcagttatc |
11778955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 22 - 74
Target Start/End: Complemental strand, 11797856 - 11797803
Alignment:
| Q |
22 |
tccacacctaaat-taacattcacaattcatttcaattatcattacatttagaa |
74 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
11797856 |
tccacacctaaacataacattcataattcatttcaattctcattgcatttagaa |
11797803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 814 times since January 2019
Visitors: 6696