View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_64 (Length: 205)
Name: NF0905_low_64
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0905_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 40809931 - 40809862
Alignment:
| Q |
1 |
agcatgttgttgttgtttcagcaaaggtcatagatgggaagaagagagtagttgagtgaggaggtatgtgg |
71 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809931 |
agcatgttgttgttgtttcagcaa-ggtcagagatgggaagaagagagtagttgagtgaggaggtatgtgg |
40809862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 937 times since January 2019
Visitors: 6707