View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0905_low_9 (Length: 440)
Name: NF0905_low_9
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0905_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 6e-41; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 236 - 390
Target Start/End: Original strand, 29843225 - 29843381
Alignment:
Q |
236 |
aacaaagaaccagagaccgacgcattaaacttatttacaacacccttttttacgtgtaatgnnnnnnnnng--ggtacaagattacgtgtaannnnnnng |
333 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
T |
29843225 |
aacaaaaaaccagagaccgacgcattaaacttatttacaacacccttttttacgtgtaatgttttttttttttggtacaagattacgtgtaatttttttg |
29843324 |
T |
 |
Q |
334 |
tttgaaaggtgagattacgtgtaatgcattcgagttgtacttactagactcacaaat |
390 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29843325 |
tttgaaaggtaagattacgtgtaatgcattcgagttgtacttactagactcacaaat |
29843381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 29843041 - 29843120
Alignment:
Q |
30 |
actaatgtgacatcaaagagtattgtgtgatctctcattattacacggcagtgtaaaaatattttacattgaaaggacat |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
T |
29843041 |
actaatgtgacatcaaagagtattgtgtgatctctcattattacacagcagtgtaaaaatgttttacattgaaaggacat |
29843120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 185 - 220
Target Start/End: Original strand, 29843196 - 29843231
Alignment:
Q |
185 |
agcatccaatcaatatcaattgaaaacctaccaaaa |
220 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| |
|
|
T |
29843196 |
agcatccaatcaatatcaattgaaaacctaacaaaa |
29843231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 298 times since January 2019
Visitors: 6696