View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_high_12 (Length: 251)
Name: NF0906_high_12
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 34719834 - 34720058
Alignment:
| Q |
1 |
ttaaactatttggggtgagaacaatcctgttagtccaaccagtgaaaacacgactcaaggttctaagaacattgaaattcttgaaagcggtcgctatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34719834 |
ttaaactatttggggtgagaacaatcatgttagtccaactagtgaaaacacgactcaaggttctaagaacattgaaattcttgaaagcggttgctatctt |
34719933 |
T |
 |
| Q |
101 |
cacagtc-taagtttgagatccacatgctggaatcgacatgttgatcaagatcactgtgccaatattctaatgaggttagaggaatatgctgattcgt-- |
197 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
34719934 |
cacagtcttgagtttgagatccacatgctggaatcgacatgttgatcaagatcaccgtgccaatattctgatgaggttagaggaatacgctgactcgttg |
34720033 |
T |
 |
| Q |
198 |
tgtgtgttatggcttgagcagtact |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34720034 |
tgtgtgttatggcttgagcagtact |
34720058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University